செல்லில் சங்கேத பாசை...

 செல்லில் சங்கேத பாசை...(water marks)




   காகிதங்களில் சங்கேத பாசைகளை எழுதுவது போய் இப்போது உயரின செல்களில் எழுதி அதை கண்டுபிடியுங்கள் என சொல்லி இருக்கிறார்கள்.... எல்லாம் அறிவியலின் சாகசம்...


    செல்லில் எப்படி சங்கேத பாசையை அமைக்க முடியும் என்றால்....அமெரிக்கா நாட்டை சேர்ந்த VENTER என்பவர் ஒரு SYNTHETIC GENOME யை உருவாக்கி இருக்கிறார்.


    அதை எப்படி உருவாக்கினார் என்பதை ஏற்க்கனவே கட்டுரை,கதையாக எழுதிவிட்டதால் இப்போது அதை இங்கு சொல்ல விரும்பவில்லை....
அரைத்த மாவை எத்தனை முறை அரைத்தாலும் அதே தோசை தன் வரும் என்பதை யாரோ எங்கோ சொல்லி இருந்தததை நான் படித்து இருக்கின்றேன்..
எனவே நான அதை இங்கு சொன்னால் அதுவும் இதே கதைதான்...


     சரி இது எப்படி சாத்தியம் என்று பார்க்கலாம். நமது உடலில் உள்ள செல்லானது குரோமோசோம்கள்,DNA கள், புரோட்டின்கள்,அமினோ அமிலங்கள்,GENE கள்..போன்றவற்றை கொண்டது. இதைத்தான் GENOME என்கிறார்கள்.
இதில் உள்ள DNA வில்தான் இந்த சங்கேத பாசையை எழுதி இருக்கிறார்கள்.




     பொதுவாக DNA எனபது ATCG (A – ADENOSINE, T – THYMINE, C- CYTOSINE...G – GUANINE) எனற நான்கு ந்யூக்ளியோடைடுகளால் ஆனது. இந்த நான்கு ந்யூக்ளியோடைடுகளும் ஒன்றோடு ஒன்று இணைந்து ஒரு நுலேணி போல் DNA வாக அமைந்து இருக்கின்றது.


     சங்கேத பாசையை எழுதி இருப்பது இந்த நன்கு எழுதுக்களில்தான் அதாவது ATCG என்ற இந்த எழுத்துக்களை செயற்கையான முறையில் மாற்றி மாற்றி ஒரு செல்லில் எழுதி இருக்கிறார்கள்.




  சரி அதற்க்கு முன் சங்கேத பாசைக்கு ஒரு உதாரணத்தை பார்க்கலாம்...


     MN ZMRVDQ.. இது ஒருவகையான சங்கேத பாசைதான்...இதை நான தெரிந்து கொண்டது DAN BROWN உடைய THE LOST SYMBOL என்ற நாவலில் இருந்து. இதற்க்கு விடை கடைசியில் கொடுத்து இருக்கின்றேன். (உடனே ஆர்வத்தில் கடைசிக்கு போகாதிர்கள் நான அங்கு கொடுக்கவில்லை இதன் நடுவில் ஒரு இடத்தில கொடுத்து இருக்கின்றேன்...)


      சரி ஒரு DNA வில் எப்படி அந்த ATCG எழுத்துக்களை மாற்றி அமைக்க முடியும் என்றால் ..இயற்கையான DNA என்றால் இந்த A ஆனது T யுடன் தான் சேரும், அதே போல் G என்பது C யுடந்தான் சேரும்.ஆனால் அவர்கள் எழுதிய DNA ஆனது மனிதனால் உருவாக்கப்பட்டது ..எனவே இயற்கையான கூட்டமைப்பில் இருந்து இதனை வேறுபடுத்தி இருக்கிறார்கள்.அல்லது எழுதி இருக்கிறார்கள்..


      அப்படி வேறுபடுத்தி எழுதியதில்தான் இந்த சங்கேத பாசையையும் சேர்த்து இருக்கிறார்கள்.


    அந்த சங்கேத பாசையில் அந்த SYNTHETIC CELL யை உருவாக்கியவர்களின் பெயர்கள் உட்பட சில வாக்கியங்களையும் சேர்த்து இருக்கிறார்கள்.


   எடுத்துகாட்டாக சில வார்த்தைகளை இங்கே கொடுத்து இருக்கின்றேன்..பாருங்கள்...




CRAIGVENTER
TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA
மேலே உள்ள ந்யூக்ளியோடைடுகளின் எழுத்துக்களில்தான் இந்த SYNTHETIC GENOME PROJECT தலைமையேற்ற VENTER ன் பெயர் இருக்கின்றது.


      இதை எந்த முறையில் எழுதி இருக்கின்றார்கள் என்றால் இந்த ந்யூக்ளியோடைடுகள் ஒன்றோடு ஒன்று இணைந்து ஒருவகையான அமினோ அமிலங்களை உருவாக்கும்.




       அப்படி இந்த ந்யூக்ளியோடைடுகலின இணைபில் உருவாகும் அமிநோ அமிலங்களை அடிப்படையாக வைத்துதான் இந்த சங்கேத பாசையை அமைத்து இருக்கிறார்கள்.


    அது எப்படி என்று கண்டு பிடிக்க நானும் என சிறிய அறிவை பயன்படுத்தி முயற்ச்சி செய்து பார்த்தேன்...கடைசிவரை முடியவேயில்லை.......பிறகு சசி..ச்சி இந்த பழம் புளிக்கும் என்று இதை விட்டு விட்டேன்...
.
     சரி நான எந்த முறையில் முயன்றேன் என சொல்லிவிட்டால் யாராவது எனக்கு உதவ எளிதாக இருக்கும்.


      முதலில் அந்த ந்யூக்ளியோடைடுகள இணைந்தால் எந்த விதமான அமினோ அமிலங்கள் உருவாகும் என்பதை கண்டறிந்தேன்.அத்தாக்கு நான் உதவியாக எடுத்து கொண்டது இந்த வலைதளத்தைத்தான்.


http://people.alfred.edu/~bde1/dna.php


      இங்கு சென்று மேலே சரியான ந்யூக்ளியோடைடுகளின் இணைப்பை கொடுத்தால் அதன் முலாம் உருவாகும் அமினோமிலத்தின் பெயரை அங்கு தெரிந்து கொள்ளலாம்.


    எடுத்துகாட்டாக மேலே உள்ள TTAA என்ற எழுத்துக்களை கொடுத்தால் Asparagines என்ற அமினோமிலத்தின் பெயர் கிடைக்கும்.


    நான் அப்படிதேரிந்து கொண்டபிறகு அதில் இருந்து எப்படி இந்த பெயர் வந்த்தது என கண்டு பிடிக்க முடியவில்லை..யாராவது உதவி செய்தால் சந்தோசம்...




     இந்த முறையில் வடிவமைதுதான் அனைத்தையும் எழுதி இருக்கிறார்கள்...அதில் ஒரு EMIAL ID யை வேறு கொடுத்து இருக்கிறார்கள்..அதை நிங்கள் கண்டுபிடித்துவிட்டால் அதற்க்கு நீங்கள் மெயில் அனுப்பலாம்.


      மேலும் அதில் சந்கேதபாசை முறையில் எழுதிய வாக்கியங்களில் எனக்கு பிடித்த இரண்டை இங்கு கொடுக்கிறேன்..


WHAT I CANT BUILD, I CANT UNDERSATND.


SEE THINGS NOT AS THEY BUT AS THEY MIGHT BE.




(இடையில் சொன்ன சங்கேத பாசைக்கு விடை NO ANSWER என்பதுதான். எப்படி என்றால்.அதில் கொடுக்கப்பட்டுள்ள எழுத்துகளுக்கு முன்னால் உள்ள எழுத்துகளை எடுத்து வாக்கியம் அமைக்கவேண்டும் அவ்வளவே...
MN ZMRVDQ NO ANSWER.)

2 comments:

Gayathri said...

மிக மிக அருமையான பதிவு..உங்களால் நிறைய கட்ட்ருக்கொண்டேன்..இதை பற்றி இன்னும் தெரிந்துகொள்ள ஆவலாய் உள்ளது...பதிவை தொடருந்தங்கள்..uibolt உங்க பாஷைதான்..நன்றி

ganesh said...

நான் நம்புகிறேன் ..நீங்கள் என்னிடம் இருந்து நிறைய கற்றுகொண்டு இருக்கிறிர்கள்...எழுத்து பிழைகளோடு எப்படி எழுதுவது என்பதையும் சேர்த்து)))))))))

நானும் அப்படித்தான் அதிக எழுத்துப்பிழைகள் செய்வேன்...பலபேர் சொன்னபிறகு இப்போது கொஞ்சம் கவனமாக இருக்கிறேன்...

கண்டிப்பாக எழுதுகிறேன்..

SGZMJR..